The fastest/easiest way to get the most out of EvoPrinterHD is to start EvoPrinting with the sample sequence provided below. Special instructions for EvoPrint analysis for bacteria are available. Many of the important steps in the procedure and data interpretations are highlighted by its analysis. The example sequence covers 2 kb of intergenic DNA flanking the Drosophila melanogaster fushi tarazu (ftz) gene and it spans 2 highly conserved regions that are most likely present in all Drosophilids. By following the steps listed below, you will discover that while both are conserved they have rearranged relative to each other in more evolutionary distant species. The key to optimizing the EvoPrinting process is to introduce the more evolutionary distant species one at a time to detect loss of alignment co-linearity due to rearrangements. Conserved sequence blocks within the rearranged DNA are subsequently identified when the second or third alignments for each species is included in the EvoPrint process.

1. Start by copy/pasting the 2 kb ftz sequence into the Drosophila EvoPrinterHD input window and selecting the "Launch eBLAT alignments" option. (Click here to copy/paste sample sequence.)
2. When the alignments have been completed, select "Check Input DNA for Repetitive Sequences" option. Single-copy repeat sequences are shown as blue-colored bases and multi-copy repeats are displayed in red-colored. If multi-copy repeats are detected, for the initial analysis consider generating EvoPrints with just the flanking sequences as the conserved sequences within the repeat may interfere with the alignments. The readout for the ftz example indicates that there are no interfering repeats in this sequence.
3. Next, select the "View Alignment Results" option. In addition to showing alignment scores, first and last aligning input DNA bases and the presence of sequencing gaps, the alignment scorecard contains links to the eBLAT alignments and to composite eBLATs. The composite eBLAT identifies those conserved sequences within the input DNA that have undergone rearrangements and/or duplications in the aligning regions of the different species included in the analysis. High alignment scores in the 2nd and 3rd eBLAT alignments indicate that at least two rearrangements have occurred relative to the reference genome. For example, composite eBLATs reveal that rearrangements containing clusters of conserved sequences are detected in the D. grimshawi, D. mojavensis, D. virilis and D. willistoni genomes.
4. After viewing the composite eBLATs, select the Continue option. The next scorecard contains quantitative information concerning the extent of conserved sequence rearrangement and/or duplication (R/D values). It also contains selection options for the different alignments that will be used to generate an EvoPrint. By default, the algorithm automatically pre-selects the 6 species closest in homology to the input reference DNA and then deselects those that have sequencing gap(s) in their highest scoring alignment region. For the initial EvoPrint, use the pre-select composite eBLATs. The EvoPrint readout highlights the D. melanogaster sequences that are conserved (uppercase black bases) in all of the pre-selected test species (D. simulans, D. sechellia, D. yakuba, D. erecta, D. ananassae and D. pseudoobscura). The EvoDifferences profile reveals those sequences that are present in all test species except one. The EvoDifferences for this analysis also indicates that all species share alignment co-linearity (indicated by an even distribution of unique base changes).
5. Return to the alignment scorecard and select the next species All option. Generate the EvoPrint and EvoDifferences profile readouts and examine the EvoDifferences profile as above. Continue to add species one at a time and examine their contribution to the EvoDifferences profile. Also include those species that have sequencing gaps one at a time to determine if the gap(s) disrupt the analysis.
   
   The final EvoDifferences profile of the ftz example sequence that includes all of the Drosophila species in the analysis is shown below.
   
   

   ftz Genomic Evodifferences Profile - Relaxed EvoPrint Black capital letters represent bases conserved in all species and colored bases represent sequences present in all species except D.simulans, D.sechellia, D.erecta, D.yakuba, D.ananassae, D.pseudoobscura, D.persimilis, D.grimshawi, D.mojavensis, D.virilis or D.willistoni.

   ttcgcaaaatctggtttgtagaatgtaaacaattatttgctccaatctgatgaattatgttctcaccgatccaac tggaaatatatatccttgcattgcttccagactcctgatcacagatgccgctattcgttagtgaagtacgtagca ttttcctggcaaaaccattaaagtacgatataaatttgaaacaaatgccaacttcaaacatatttaaatgtttca agggggcggacatccccagctgAGCTGTCAAAtcgAaCAcCGACCTTGGCCATTAATCgTccCATTCAtGTCAAA TTTGgACAATTCgAATGTCAATgGAGAAAGTTTtcagccagcctccgacgcgtcagcaGAAAAATCAATAATTC gAACGCGTGAATTtCCATTAACAATTTGcTTtGgCGAACTTGAAACGTgaagcacacaaaacAcgagaAGCCTTG AAacgacgcTAAAAAATAAATTAGAAAATTCCtccgcacccgccGgCACATGTGCAagagaacccagtgaaattt tccacctccattgccgtggagctgaggccatcgactccgctgctcagaattagggttttcatggggtgtggaggg caaaatctgtgaggcggggatgttggcgccttgccttatttgagtacatgcaggaggaggattttcagtGTGTct gaAAATGgAAATTctgtgtgcgattcgctcACTGaCTGACTGACACATATTTGGGCATGATCAAAATTAATGACC CaGCgCTcatataggcccatcaactcgagcacagagacaccttggcacacacactagactgatgcaacatacgaa ctgaatttgggtcaatggctcacgtttttttttttttcggtgaatcttttttctaaaacgtaagttttcttcaaa tataaaaataactagccatgtttctattacaacacatcttataagccacatataatacttttagacaaagtaaaa acttaaatggaaaacaaatatattttgtattgatttgacgtcagtctaaaacaggaagaatcataagaaatagca ccaagagcttttaattcatcactctcgttgttcattgtatattgtatataattgtctataaacggcttggttatg gtttgtgggaagctaagtaagcttctctgcatcacaacgctcaataattcctgaaatcagcataaaaggtgggat tgcagacagccccaaaagcaaaccacccaacgatcgtatctgcaccgcccttgtgcaaatatcatttcgcggatt cttttgcagccgtttagcgtcacatgcaatttgccatcattccgagctaaacgctctTTTTgAcCCGaGCTGTCG GTTATTAAAAGtCATAATTGAATTTCTTGtAAACAGTTGTTgGTTGTGAAAGATGTGGCCcGAACATGCAAAAtc gcagaaataaggggctgaagggtataggatgGggaATCCgGcCTGGCGCTgAAATTTCGAAAGTATGAAAAAAGC AATTAAAACTGAAATAATGAATTCTTTCTTTtGCcagtctctggcaTGTTtctcgttcgaggttggagttgaatt cggagtcggagttggctggctggctgccttgctGGTgAAGGGATtggccttcgtttcacccatcaccgccagaaa atttcccGGGCTGATTAGCATGAGGCGTAACAGTTTTTAATTGCAGCCACATTTcgccgagctccgaatgtgcag caacaaaagcctggcaacacataatgatagcaatACTTATCTTGCCATCAGAAAGTcGAAAAAgTTtaagcactt tttcaaTTTTTTttgTAAcAAccaccaatgcttctatgcgacagctttccctctactgtgacttctttagatgtt ttcggctggattgatatattttatttcgtttaaaagattgttaaaagaaaactAAACTAGAACTGAggcAcaTTT TTTGTgtgcTTTATTTTTTctagttcacgggattatttttcgacgatttt

   75 150 225 300 375 450 525 600 675 750 825 900 975 1050 1125 1200 1275 1350 1425 1500 1575 1650 1725 1800 1875 1950 2025

   
   

   ---

   Return to EvoPrinterHD home.