D. melanogaster fushi tarazu genomic DNA sequence (training example)

TTCGCAAAATCTGGTTTGTAGAATGTAAACAATTATTTGCTCCAATCTGA
TGAATTATGTTCTCACCGATCCAACTGGAAATATATATCCTTGCATTGCT
TCCAGACTCCTGATCACAGATGCCGCTATTCGTTAGTGAAGTACGTAGCA
TTTTCCTGGCAAAACCATTAAAGTACGATATAAATTTGAAACAAATGCCA
ACTTCAAACATATTTAAATGTTTCAAGGGGGCGGACATCCCCAGCTGAGC
TGTCAAATCGAACACCGACCTTGGCCATTAATCGTCCCATTCATGTCAAA
TTTGGACAATTCGAATGTCAATGGAGAAAGTTTTCAGCCAGCCTCCGACG
CGTCAGCAGAAAAATCAATAATTCCGAACGCGTGAATTTCCATTAACAAT
TTGCTTTGGCGAACTTGAAACGTGAAGCACACAAAACACGAGAAGCCTTG
AAACGACGCTAAAAAATAAATTAGAAAATTCCTCCGCACCCGCCGGCACA
TGTGCAAGAGAACCCAGTGAAATTTTCCACCTCCATTGCCGTGGAGCTGA
GGCCATCGACTCCGCTGCTCAGAATTAGGGTTTTCATGGGGTGTGGAGGG
CAAAATCTGTGAGGCGGGGATGTTGGCGCCTTGCCTTATTTGAGTACATG
CAGGAGGAGGATTTTCAGTGTGTCTGAAAATGGAAATTCTGTGTGCGATT
CGCTCACTGACTGACTGACACATATTTGGGCATGATCAAAATTAATGACC
CAGCGCTCATATAGGCCCATCAACTCGAGCACAGAGACACCTTGGCACAC
ACACTAGACTGATGCAACATACGAACTGAATTTGGGTCAATGGCTCACGT
TTTTTTTTTTTTCGGTGAATCTTTTTTCTAAAACGTAAGTTTTCTTCAAA
TATAAAAATAACTAGCCATGTTTCTATTACAACACATCTTATAAGCCACA
TATAATACTTTTAGACAAAGTAAAAACTTAAATGGAAAACAAATATATTT
TGTATTGATTTGACGTCAGTCTAAAACAGGAAGAATCATAAGAAATAGCA
CCAAGAGCTTTTAATTCATCACTCTCGTTGTTCATTGTATATTGTATATA
ATTGTCTATAAACGGCTTGGTTATGGTTTGTGGGAAGCTAAGTAAGCTTC
TCTGCATCACAACGCTCAATAATTCCTGAAATCAGCATAAAAGGTGGGAT
TGCAGACAGCCCCAAAAGCAAACCACCCAACGATCGTATCTGCACCGCCC
TTGTGCAAATATCATTTCGCGGATTCTTTTGCAGCCGTTTAGCGTCACAT
GCAATTTGCCATCATTCCGAGCTAAACGCTCTTTTTGACCCGAGCTGTCG
GTTATTAAAAGTCATAATTGAATTTCTTGTAAACAGTTGTTGGTTGTGAA
AGATGTGGCCCGAACATGCAAAATCGCAGAAATAAGGGGCTGAAGGGTAT
AGGATGGGGAATCCGGCCTGGCGCTGAAATTTCGAAAGTATGAAAAAAGC
AATTAAAACTGAAATAATGAATTCTTTCTTTTGCCAGTCTCTGGCATGTT
TCTCGTTCGAGGTTGGAGTTGAATTCGGAGTCGGAGTTGGCTGGCTGGCT
GCCTTGCTGGTGAAGGGATTGGCCTTCGTTTCACCCATCACCGCCAGAAA
ATTTCCCGGGCTGATTAGCATGAGGCGTAACAGTTTTTAATTGCAGCCAC
ATTTCGCCGAGCTCCGAATGTGCAGCAACAAAAGCCTGGCAACACATAAT
GATAGCAATACTTATCTTGCCATCAGAAAGTCGAAAAAGTTTAAGCACTT
TTTCAATTTTTTTTGTAACAACCACCAATGCTTCTATGCGACAGCTTTCC
CTCTACTGTGACTTCTTTAGATGTTTTCGGCTGGATTGATATATTTTATT
TCGTTTAAAAGATTGTTAAAAGAAAACTAAACTAGAACTGAGGCACATTT
TTTGTGTGCTTTATTTTTTCTAGTTCACGGGATTATTTTTCGACGATTTT